Skip to main content

pHREP-KD-2-shCtrl
(Plasmid #240580)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240580 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHREP-KD-2
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418), Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Scramble shRNA
  • gRNA/shRNA sequence
    TCGGCCGCGATTAGGCTGTTAT
  • Species
    G. gallus (chicken)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHREP-KD-2-shCtrl was a gift from Lienhard Schmitz (Addgene plasmid # 240580 ; http://n2t.net/addgene:240580 ; RRID:Addgene_240580)
  • For your References section:

    A novel approach towards a histone replacement system in Tetrapods. Pfisterer M, Pritz A, Parry A, Schmitz ML. PLoS One. 2026 Feb 10;21(2):e0342014. doi: 10.1371/journal.pone.0342014. eCollection 2026. 10.1371/journal.pone.0342014 PubMed 41666149