ACE2-HA-Linker-FLAG
(Plasmid
#240602)
-
PurposeEncodes doubly tagged ACE2 protein. HA on the N-terminal added after the signal peptide (a.a 1-17) and FLAG tag at the end of the insert. A linker sequence was added after the HA tag.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240602 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(-)
- Backbone size w/o insert (bp) 5365
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAngiotensin-converting enzyme 2
-
Alt nameACE2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2517
-
Entrez GeneACE2 (a.k.a. ACEH)
- Promoter CMV
-
Tags
/ Fusion Proteins
- HA tag (after the signal peptide) (N terminal on insert)
- FLAG tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV Promoter (F): ATTGACGCAAATGGGCGGTA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byHyeryun Choe (Addgene Plasmid #1786)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was modified from AddGene plasmid #1786 (insertion of tags at the N- and C-terminals)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ACE2-HA-Linker-FLAG was a gift from Zaid Abassi (Addgene plasmid # 240602 ; http://n2t.net/addgene:240602 ; RRID:Addgene_240602)