Skip to main content

ACE2-Mutant-C3
(Plasmid #240607)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240607 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(-)
  • Backbone size w/o insert (bp) 5378
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Angiotensin-converting enzyme 2
  • Alt name
    ACE2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2472
  • Mutation
    Arginine (R) and Lysine (K) residues on ACE2-cluster 3 (C3 amio acids range 676-689) are substituted by alanine (A)
  • Entrez Gene
    ACE2 (a.k.a. ACEH)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV Promoter (F): ATTGACGCAAATGGGCGGTA
  • 3′ sequencing primer bGH-R primer: TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Hyeryun Choe (Addgene Plasmid #1786)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The sequences encoding ACE2 mutants with a C-terminal FLAG tag were generated in two steps. In step 1, ACE2 mutant inserts were generated by overlap-extension PCR with specific primers. In step 2, the mutated ACE2 PCR insert was inserted into pcDNA 3.1 vector using the NEBuilder HiFi DNA Assembly kit. The integrity of all PCR-amplified sequences was confirmed by automated sequence analysis.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ACE2-Mutant-C3 was a gift from Zaid Abassi (Addgene plasmid # 240607 ; http://n2t.net/addgene:240607 ; RRID:Addgene_240607)