ACE2-Mutant-C3
(Plasmid #240607)

• Purpose: To test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 3 located within the collectrin-like site on ACE2
• Depositing Lab: Zaid Abassi
• Publication: Zaid Abassi Lab Plasmids 2025 (unpublished)

Backbone

• Vector backbone: pcDNA3.1(-)
• Backbone size w/o insert (bp): 5378
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Angiotensin-converting enzyme 2
• Alt name: ACE2
• Species: H. sapiens (human)
• Insert Size (bp): 2472
• Mutation: Arginine (R) and Lysine (K) residues on ACE2-cluster 3 (C3 amio acids range 676-689) are substituted by alanine (A)
• Entrez Gene: ACE2 (a.k.a. ACEH)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV Promoter (F): ATTGACGCAAATGGGCGGTA
• 3′ sequencing primer: bGH-R primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • ACE2-Mutant-C3.gb
• A portion of this plasmid was derived from a plasmid made by: Hyeryun Choe (Addgene Plasmid #1786)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The sequences encoding ACE2 mutants with a C-terminal FLAG tag were generated in two steps. In step 1, ACE2 mutant inserts were generated by overlap-extension PCR with specific primers. In step 2, the mutated ACE2 PCR insert was inserted into pcDNA 3.1 vector using the NEBuilder HiFi DNA Assembly kit. The integrity of all PCR-amplified sequences was confirmed by automated sequence analysis.