TMPRSS2-Mutant-R255A
(Plasmid
#240612)
-
PurposeTo test the cleavage of ACE2 by a non-autocleavable form of TMPRSS2 (Less active form)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLEX307
- Backbone size w/o insert (bp) 8416
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameType II transmembrane serine protease
-
Alt nameTMPRSS2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1479
-
MutationArginine (R) at position 255 is replaced by alanine (A) generating a non-autocleavable form of TMPRSS2 protease
-
Entrez GeneTMPRSS2 (a.k.a. PRSS10)
- Promoter EF-1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer EF-1a (F): TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAlejandro Chavez & Sho Iketani (Addgene Plasmid #158457)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TMPRSS2-Mutant-R255A was a gift from Zaid Abassi (Addgene plasmid # 240612 ; http://n2t.net/addgene:240612 ; RRID:Addgene_240612)