Skip to main content

MasR-HA
(Plasmid #240613)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240613 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone size w/o insert (bp) 5564
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MAS1 receptor
  • Alt name
    MasR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1008
  • Entrez Gene
    MAS1 (a.k.a. MAS, MGRA)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CMV Promoter (F): ATTGACGCAAATGGGCGGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We generated the MasR insert by amplification of human genomic DNA with the primers F: CAAGCTTGGTACCGAGCTCGGATCCTACCCATACGATGTTCCAGATTACGCGATGGATGGGTCAAACGTG; R:AGTGTGATGGATATCTGCAGAATTCTTTCATCATTAATTAGTATCTCATGC; this is because the MasR insert is composed of one Exon.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MasR-HA was a gift from Zaid Abassi (Addgene plasmid # 240613 ; http://n2t.net/addgene:240613 ; RRID:Addgene_240613)