MasR-HA
(Plasmid
#240613)
-
PurposeEncodes MasR, a receptor on RAAS that antagonizes the AT1R physiological effects.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240613 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 5564
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMAS1 receptor
-
Alt nameMasR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1008
-
Entrez GeneMAS1 (a.k.a. MAS, MGRA)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CMV Promoter (F): ATTGACGCAAATGGGCGGTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We generated the MasR insert by amplification of human genomic DNA with the primers F: CAAGCTTGGTACCGAGCTCGGATCCTACCCATACGATGTTCCAGATTACGCGATGGATGGGTCAAACGTG; R:AGTGTGATGGATATCTGCAGAATTCTTTCATCATTAATTAGTATCTCATGC; this is because the MasR insert is composed of one Exon.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MasR-HA was a gift from Zaid Abassi (Addgene plasmid # 240613 ; http://n2t.net/addgene:240613 ; RRID:Addgene_240613)