Skip to main content

AT1R-HA
(Plasmid #240614)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240614 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone size w/o insert (bp) 5383
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Angiotensin II Type 1 Receptor
  • Alt name
    AT1R
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1110
  • Entrez Gene
    AGTR1 (a.k.a. AG2S, AGTR1B, AT1, AT1AR, AT1B, AT1BR, AT1R, AT2R1, ATR1, HAT1R)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CMV Promoter (F): ATTGACGCAAATGGGCGGTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Bryan Roth (Addgene Plasmid #66222)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AT1R-HA was a gift from Zaid Abassi (Addgene plasmid # 240614 ; http://n2t.net/addgene:240614 ; RRID:Addgene_240614)