AT1R-HA
(Plasmid
#240614)
-
PurposeEncodes AT1R, a key receptor on RAAS that regulated blood pressure
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 5383
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAngiotensin II Type 1 Receptor
-
Alt nameAT1R
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1110
-
Entrez GeneAGTR1 (a.k.a. AG2S, AGTR1B, AT1, AT1AR, AT1B, AT1BR, AT1R, AT2R1, ATR1, HAT1R)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CMV Promoter (F): ATTGACGCAAATGGGCGGTA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBryan Roth (Addgene Plasmid #66222)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AT1R-HA was a gift from Zaid Abassi (Addgene plasmid # 240614 ; http://n2t.net/addgene:240614 ; RRID:Addgene_240614)