pHAGE2-palm-mScar3-10xSunTag
(Plasmid #240626)

• Purpose: Expresses a fusion construct containing a palmitoylation motif, mScarlet3 and 10 repeats of the SunTag (GCN4) peptide, to luminally tag extracellular vesicles for use in EV-FUSIM assay.
• Depositing Lab: Esther Nolte-'t Hoen
• Publication: van den Ende et al J Extracell Vesicles. 2026 Mar;15(3):e70228. doi: 10.1002/jev2.70228.

Backbone

• Vector backbone: pHAGE2
• Backbone size w/o insert (bp): 8190
• Total vector size (bp): 9697
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: palm-mScarlet3-10xSunTag
• Species: Synthetic
• Insert Size (bp): 1506
• Promoter: EF1a

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There is a minor discrepancy between the Addgene NGS sequence and the depositor sequence: LoxP site present in reference sequence, but absent in Addgene NGS sequence. Depositor confirms this is not of concern for plasmid function.