pCMV-VSVG-mScar3-10xSunTag
(Plasmid
#240630)
-
PurposeExpresses VSV-G, C-terminally fused to mScarlet3 and 10 repeats of the SunTag (GCN4) peptide, to luminally tag VSV-G-induced extracellular vesicles for use in EV-FUSIM assay.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240630 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4133
- Total vector size (bp) 7112
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVSVG-mScarlet3-10xSunTag
-
SpeciesSynthetic; Vesicular Stomatitis Virus
-
Insert Size (bp)2979
- Promoter CMV
-
Tag
/ Fusion Protein
- mScarlet3 and 10xSunTag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-VSVG-mScar3-10xSunTag was a gift from Esther Nolte-'t Hoen (Addgene plasmid # 240630 ; http://n2t.net/addgene:240630 ; RRID:Addgene_240630) -
For your References section:
Development of a Live-Cell Imaging Assay to Elucidate Spatiotemporal Dynamics of Extracellular Vesicle Fusion with Target Cells. van den Ende J, Defourny KAY, Rabouw HH, Tanenbaum ME, Wubbolts RW, Nolte-'t Hoen ENM. J Extracell Vesicles. 2026 Mar;15(3):e70228. doi: 10.1002/jev2.70228. 10.1002/jev2.70228 PubMed 41764601