mU6-sgRNA-CLTA-mCherry
(Plasmid
#240637)
-
PurposeVector for expressing an sgRNA targeting CLTA promoter from the mouse U6 promoter and a puromycin resistance cassette and mCherry from the EF1Alpha promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240637 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSICO derivative
- Backbone size w/o insert (bp) 3996
- Total vector size (bp) 5499
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepuro-T2A-mCherry
-
gRNA/shRNA sequenceCTGTGGTGCCGACTGGGAGC
-
SpeciesH. sapiens (human)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mU6-sgRNA-CLTA-mCherry was a gift from James Nuñez (Addgene plasmid # 240637 ; http://n2t.net/addgene:240637 ; RRID:Addgene_240637) -
For your References section:
Programmable epigenome editing by transient delivery of CRISPR epigenome editor ribonucleoproteins. Xu D, Besselink S, Ramadoss GN, Dierks PH, Lubin JP, Pattali RK, Brim JI, Christenson AE, Colias PJ, Ornelas IJ, Nguyen CD, Chasins SE, Conklin BR, Nunez JK. Nat Commun. 2025 Aug 26;16(1):7948. doi: 10.1038/s41467-025-63167-x. 10.1038/s41467-025-63167-x PubMed 40858609