pCR158
(Plasmid #240639)

• Purpose: Expression of NLS-Kaede in Exaiptasia diaphana
• Depositing Lab: John Pringle
• Publication: Aiptasia Genetic Tools Plasmids (unpublished)

Backbone

• Vector backbone: pNvT-MHC::mCh
• Backbone manufacturer: Lab of Ulrich Technau
• Backbone size w/o insert (bp): 4115
• Total vector size (bp): 6645
• Vector type: Expression of NLS-Kaede in Exaiptasia diaphana
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: AIPGENE865 promoter
• Alt name: Exaiptasia diaphana Elongation Factor 1 alpha promoter
• Species: Exaiptasia diaphana
• Insert Size (bp): 1810
• Mutation: naturally occurring 749-bp insertion at bp 628 (from bp 1 of plasmid map), corrected exon/intron positions (in agreement with XM_021048156.2).
• GenBank ID: KXJ12416.1 XM_021048156.2
• Promoter: Exaiptasia diaphana Elongation Factor 1 alpha (AIPGENE865) promoter

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13_rev (CAGGAAACAGCTATGAC)
• 3′ sequencing primer: Kaede_start_seq_rev (CATTTCTGGTTTAATCAGACTC)

Gene/Insert 2

• Gene/Insert name: Kaede
• Species: Trachyphyllia geoffroyi
• Insert Size (bp): 678
• GenBank ID: BAC20344.1
• Tag / Fusion Protein:
  • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: Kaede_mid_seq_rev (AGTCTTCTTCTGCATAACAGG)
• 3′ sequencing primer: Kaede_mid_seq_fw (GAGCGAAGCCTGATGTTCG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pCS107-Kaede (source of the Kaede gene) is unpublished and was a kind gift from Julie C. Baker. pNvT-MHC::mCh (source of backbone): Renfer E, Amon-Hassenzahl A, Steinmetz PRH, Technau U. 2010. A muscle-specific transgenic reporter line of the sea anemone, Nematostella vectensis. Proc Natl Acad Sci USA. 107(1):104–108. doi:10.1073/pnas.0909148107.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The whole intergenic region between AIPGENE865 (KXJ12416.1; Elongation Factor 1alpha) and AIPGENE899 was cloned as promoter fragment. The original gene annotation for AIPGENE865 is incorrect, the automatic NCBI annotation is correct in regards of exons, introns and translation start site. We found that Aiptasia strain CC7 was actually heterozygous for that locus: one allele was mostly in agreement with the genome sources but the other one had a couple of SNPs and a large, 749-bp insert in the intergenic region. The longer version with insert was used as promoter for this plasmid.