pCAG1.1-Galntl5 (20 kDa)-3xHA
(Plasmid
#240648)
-
PurposeThe nucleotides coding 20 kDa from the C-terminus of mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 240648 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG1.1
-
Backbone manufacturerkindly gifted from Dr Masahito Ikawa (Addgene Plasmid ID #173685)
- Backbone size w/o insert (bp) 5180
- Total vector size (bp) 5817
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
-
Alt nameGalntl5
-
Alt name1700021B12Rik
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)654
-
GenBank IDENSMUSG00000028938
-
Entrez GeneGalntl5 (a.k.a. 1700021B12Rik, Galnt15)
- Promoter CAG
-
Tag
/ Fusion Protein
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- 3′ sequencing primer GAAGTCAGATGCTCAAGGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG1.1-Galntl5 (20 kDa)-3xHA was a gift from Taichi Noda (Addgene plasmid # 240648 ; http://n2t.net/addgene:240648 ; RRID:Addgene_240648) -
For your References section:
GALNTL5 binds GalNAc and is required for migration through the uterotubal junction and sperm-zona pellucida binding. Noda T, Uriu R, Mashiko D, Shinohara H, Qu Y, Taira A, Matzuk RM, Tahala D, Nakano M, Araki K, Yu Z, Zhang Y, Matzuk MM, Ikawa M. Nat Commun. 2025 Sep 17;16(1):8264. doi: 10.1038/s41467-025-63805-4. 10.1038/s41467-025-63805-4 PubMed 40962834