Skip to main content
Addgene
Open Menu

pCAG1.1-Galntl5 (10 kDa)-3xHA
(Plasmid #240649)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240649 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pCAG1.1
  • Backbone manufacturer
    kindly gifted from Dr Masahito Ikawa (Addgene Plasmid ID #173685)
  • Backbone size w/o insert (bp) 5180
  • Total vector size (bp) 5538
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
  • Alt name
    Galntl5
  • Alt name
    1700021B12Rik
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    375
  • GenBank ID
    ENSMUSG00000028938
  • Entrez Gene
    Galntl5 (a.k.a. 1700021B12Rik, Galnt15)
  • Promoter CAG
  • Tag / Fusion Protein
    • 3xHA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
  • 3′ sequencing primer GAAGTCAGATGCTCAAGGGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG1.1-Galntl5 (10 kDa)-3xHA was a gift from Taichi Noda (Addgene plasmid # 240649 ; http://n2t.net/addgene:240649 ; RRID:Addgene_240649)

  • For your References section:

    GALNTL5 binds GalNAc and is required for migration through the uterotubal junction and sperm-zona pellucida binding. Noda T, Uriu R, Mashiko D, Shinohara H, Qu Y, Taira A, Matzuk RM, Tahala D, Nakano M, Araki K, Yu Z, Zhang Y, Matzuk MM, Ikawa M. Nat Commun. 2025 Sep 17;16(1):8264. doi: 10.1038/s41467-025-63805-4. 10.1038/s41467-025-63805-4 PubMed 40962834
Related items: