Skip to main content

pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-seq2
(Plasmid #240865)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240865 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX601
  • Total vector size (bp) 7500
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U6 driven sgRNA Targeting exon 1 of EZR
  • Alt name
    EZR
  • gRNA/shRNA sequence
    CCGTCGCCTCCGCCGTACAG
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_009510.2
  • Entrez Gene
    Ezr (a.k.a. Vil2, p81)
  • Promoter GfaABC1D
  • Tag / Fusion Protein
    • SaCas9 + 3X HA-Tag

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-seq2 was a gift from Mark Verheijen (Addgene plasmid # 240865 ; http://n2t.net/addgene:240865 ; RRID:Addgene_240865)
  • For your References section:

    Retraction of Astrocyte Leaflets From the Synapse Enhances Fear Memory. Badia-Soteras A, Heistek TS, Kater MSJ, Mak A, Negrean A, van den Oever MC, Mansvelder HD, Khakh BS, Min R, Smit AB, Verheijen MHG. Biol Psychiatry. 2023 Aug 1;94(3):226-238. doi: 10.1016/j.biopsych.2022.10.013. Epub 2022 Oct 29. 10.1016/j.biopsych.2022.10.013 PubMed 36702661