pCMVp_eGFP
(Plasmid
#241002)
-
PurposeFor targeted gene knock-in at NHP IGH locus and constitutive expression of GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241002 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-GFP
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 3925
- Total vector size (bp) 6175
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)2250
-
Entrez GeneeGFP (a.k.a. pPRS3a_01)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATGGACATTCTGCCATTGTGAT
- 3′ sequencing primer CTGTGCTAGTATTTCTTAGCTAA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.02.651933 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMVp_eGFP was a gift from Jennifer Adair (Addgene plasmid # 241002 ; http://n2t.net/addgene:241002 ; RRID:Addgene_241002) -
For your References section:
In vivo production of an anti-HIV antibody in mice by non-viral gene knock-in in primate hematopoietic stem and progenitor cells. Castelli JMP, Poljakov K, Jwa Y, Cunningham R, Cassidy ME, Gray MD, Sanchez Gaytan JN, Enstrom MR, Gastelum G, Wang Z, Linton JD, Rongvaux A, Taylor JJ, Adair JE. Mol Ther. 2026 Feb 2:S1525-0016(26)00081-X. doi: 10.1016/j.ymthe.2026.01.038. 10.1016/j.ymthe.2026.01.038 PubMed 41635086