Skip to main content

pCMVp_eGFP
(Plasmid #241002)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 241002 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-GFP
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 3925
  • Total vector size (bp) 6175
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Species
    Synthetic
  • Insert Size (bp)
    2250
  • Entrez Gene
    eGFP (a.k.a. pPRS3a_01)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATGGACATTCTGCCATTGTGAT
  • 3′ sequencing primer CTGTGCTAGTATTTCTTAGCTAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.05.02.651933 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMVp_eGFP was a gift from Jennifer Adair (Addgene plasmid # 241002 ; http://n2t.net/addgene:241002 ; RRID:Addgene_241002)
  • For your References section:

    In vivo production of an anti-HIV antibody in mice by non-viral gene knock-in in primate hematopoietic stem and progenitor cells. Castelli JMP, Poljakov K, Jwa Y, Cunningham R, Cassidy ME, Gray MD, Sanchez Gaytan JN, Enstrom MR, Gastelum G, Wang Z, Linton JD, Rongvaux A, Taylor JJ, Adair JE. Mol Ther. 2026 Feb 2:S1525-0016(26)00081-X. doi: 10.1016/j.ymthe.2026.01.038. 10.1016/j.ymthe.2026.01.038 PubMed 41635086