pET-21_GSS-6xHis-SUMO-VidC-bla-FLAG
(Plasmid
#241012)
-
PurposeVidC-bla construct that can be purified via His-tag and undergo N-terminal conjugation using the VEPL system.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-21
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6894
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGSS-6xHis-SUMO-VidC-bla-FLAG
-
SpeciesSynthetic
-
Insert Size (bp)1548
- Promoter T7
-
Tags
/ Fusion Proteins
- His-tag (N terminal on insert)
- SUMO-tag (N terminal on insert)
- FLAG-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-21_GSS-6xHis-SUMO-VidC-bla-FLAG was a gift from Cole DeForest (Addgene plasmid # 241012 ; http://n2t.net/addgene:241012 ; RRID:Addgene_241012) -
For your References section:
One-Step Purification and N-Terminal Functionalization of Bioactive Proteins via Atypically Split Inteins. Gharios R, Li A, Kopyeva I, Francis RM, DeForest CA. Bioconjug Chem. 2024 Jun 19;35(6):750-757. doi: 10.1021/acs.bioconjchem.4c00223. Epub 2024 May 30. 10.1021/acs.bioconjchem.4c00223 PubMed 38815180