pCRISPR-EASY
(Plasmid
#241237)
-
Purpose(Empty Backbone) CRISPR-Cas9 genome editing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 241237 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1/pEF6-nls-YFP-2A-Cas9
- Backbone size (bp) 11935
-
Modifications to backbonepEF6-nls-YFP-2A-Cas9 was digested with AatII and re-ligated. The cas9 gene was mutated to remove the two BsmBI recognition sequences but maintain the encoded protein sequence. The sgRNA scaffold from LentiCRISPRv2 (Addgene plasmid #52961) introduced at the AatII site.
-
Vector typeMammalian Expression, CRISPR
- Promoter U6
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer sgRNAseqF: TGTCTCATGAGCGGATACATATTTGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid is a derivative of pEF6-nls-YFP-2A-Cas9 (Bowman et al., (2017) Cell Chem Biol, PMID 28479296)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR-EASY was a gift from Tamara O'Connor (Addgene plasmid # 241237 ; http://n2t.net/addgene:241237 ; RRID:Addgene_241237) -
For your References section:
An efficient and cost-effective method for disrupting genes in RAW264.7 macrophages using CRISPR-Cas9. Hossain MJ, O'Connor TJ. PLoS One. 2024 Mar 14;19(3):e0299513. doi: 10.1371/journal.pone.0299513. eCollection 2024. 10.1371/journal.pone.0299513 PubMed 38483963