PX458 BLTP3A knockout
(Plasmid
#241256)
-
PurposeKnock-out plasmid targeting the second exon of human BLTP3A (UHRF1BP1)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX458
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBLTP3A (UHRF1BP1) KO gRNA
-
gRNA/shRNA sequenceTCACTCGGGTCTACTGCAAC
-
SpeciesH. sapiens (human)
-
Entrez GeneBLTP3A (a.k.a. C6orf107, ICBP90, SHIP164B, UHRF1BP1, dJ349A12.1)
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458 BLTP3A knockout was a gift from Pietro De Camilli (Addgene plasmid # 241256 ; http://n2t.net/addgene:241256 ; RRID:Addgene_241256) -
For your References section:
BLTP3A is associated with membranes of the late endocytic pathway and is an effector of CASM. Hanna MG, Rodriguez Cruz HO, Fujise K, Wu Y, Xu CS, Pang S, Li Z, Monetti M, De Camilli P. EMBO J (2025) 44: 6168 - 6195 10.1038/s44318-025-00543-9 PubMed 39386594