CMV-mCherry
(Plasmid
#241313)
-
PurposeExpression of mCherry protein in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241313 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMAX
- Total vector size (bp) 3518
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry fluorescent protein
-
Insert Size (bp)711
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Other
- 5′ sequencing primer CMV_Fwd: CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-mCherry was a gift from Stavros Lomvardas (Addgene plasmid # 241313 ; http://n2t.net/addgene:241313 ; RRID:Addgene_241313)