tetO-Mex3a_HyperTRIBE-adar_deaminase-V5-t2a-mCherry
(Plasmid #241315)

• Purpose: inducible Mex3a fused to mouse Adar Deaminase domain (HyperTRIBE) and V5 with t2a mCherry for expression in mammalian cells
• Depositing Lab: Stavros Lomvardas
• Publication: Stemness factor Mex3a times translation and protein trafficking to ensure robust differentiation of olfactory sensory neurons (unpublished)

Backbone

• Vector backbone: pTRE2
• Total vector size (bp): 7323
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Mex3a
• Species: M. musculus (mouse)
• Insert Size (bp): 1560
• Entrez Gene: Mex3a (a.k.a. 2700083E18Rik, Gm411, Rkhd4)
• Promoter: tetO and CMV
• Tags / Fusion Proteins:
  • Adar_deaminase_domain (C terminal on insert)
  • V5 (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Other
• 5′ sequencing primer: pTRE_Seq_Fwd: AATTCGAGCTCGGTACCCGG

Gene/Insert 2

• Gene/Insert name: Adar deaminase domain
• Species: M. musculus (mouse)
• Insert Size (bp): 1149
• Mutation: E957Q
• Entrez Gene: Adar (a.k.a. Adar1, Adar1p110, Adar1p150, DRADA, mZaADAR)
• Tag / Fusion Protein:
  • V5

Resource Information

• Supplemental Documents:
  • TetO-Mex3a_HyperTRIBE_Adar_V5_2a_mCherry.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mex3a is fused to the HyperTRIBE domain and V5, followed by a t2a-mCherry. Mex3a underlying DNA sequence was altered to reduce GC content, but amino acid sequence is conserved to mm10 Mex3a. The "HyperTRIBE" mutation of the adar deaminase domain is E488Q in drosophila and is conserved at the E957Q amino acid in the mouse Adar gene (amino acid references transcript uc008pzx.2 which is 1178 amino acids in length). The Adar fusion insert is a C-terminal truncation of the total Adar gene from T788 to F1170 - which spans the deaminase domain