tetO-Mex3a_HyperTRIBE-adar_deaminase-V5-t2a-mCherry
(Plasmid
#241315)
-
Purposeinducible Mex3a fused to mouse Adar Deaminase domain (HyperTRIBE) and V5 with t2a mCherry for expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRE2
- Total vector size (bp) 7323
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameMex3a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1560
-
Entrez GeneMex3a (a.k.a. 2700083E18Rik, Gm411, Rkhd4)
- Promoter tetO and CMV
-
Tags
/ Fusion Proteins
- Adar_deaminase_domain (C terminal on insert)
- V5 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Other
- 5′ sequencing primer pTRE_Seq_Fwd: AATTCGAGCTCGGTACCCGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAdar deaminase domain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1149
-
MutationE957Q
-
Entrez GeneAdar (a.k.a. Adar1, Adar1p110, Adar1p150, DRADA, mZaADAR)
-
Tag
/ Fusion Protein
- V5
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mex3a is fused to the HyperTRIBE domain and V5, followed by a t2a-mCherry. Mex3a underlying DNA sequence was altered to reduce GC content, but amino acid sequence is conserved to mm10 Mex3a. The "HyperTRIBE" mutation of the adar deaminase domain is E488Q in drosophila and is conserved at the E957Q amino acid in the mouse Adar gene (amino acid references transcript uc008pzx.2 which is 1178 amino acids in length). The Adar fusion insert is a C-terminal truncation of the total Adar gene from T788 to F1170 - which spans the deaminase domain
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tetO-Mex3a_HyperTRIBE-adar_deaminase-V5-t2a-mCherry was a gift from Stavros Lomvardas (Addgene plasmid # 241315 ; http://n2t.net/addgene:241315 ; RRID:Addgene_241315)