CMV-Serbp1-meGFP
(Plasmid
#241316)
-
Purposemouse Serbp1 fused to meGFP for expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241316 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-15F11-HA-mEGFP
-
Backbone manufactureraddgene Plasmid #129590
- Total vector size (bp) 5988
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSerbp1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2019
-
Entrez GeneSerbp1 (a.k.a. 1200009K13Rik, 9330147J08Rik, Pairbp1)
- Promoter CMV
-
Tag
/ Fusion Protein
- meGFP (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CMV_Fwd: cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-Serbp1-meGFP was a gift from Stavros Lomvardas (Addgene plasmid # 241316 ; http://n2t.net/addgene:241316 ; RRID:Addgene_241316)