pcDNA3.1-MSTN-C313Y
(Plasmid
#241324)
-
PurposeExpresses bovine MSTN (p.C313Y) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241324 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1 (+)
-
Backbone manufacturerInvitrogen (Life Technologies)
- Backbone size w/o insert (bp) 5431
- Total vector size (bp) 11679
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMSTN full gene
-
Alt nameMyostatin
-
SpeciesB. taurus (bovine)
-
Insert Size (bp)6248
-
Mutationp.C313Y
-
GenBank IDGeneID:281187
-
Entrez GeneMSTN (a.k.a. GDF8)
- Promoter CMV
Cloning Information
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS finds six natural variants within MSTN intron 1 (NC_037329.1). The depositor confirms these intronic variants have no detectable effect on plasmid function, and that the plasmid has been tested and found fully functional in terms of RNA expression and splicing.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-MSTN-C313Y was a gift from Mathilde Dupont-Nivet (Addgene plasmid # 241324 ; http://n2t.net/addgene:241324 ; RRID:Addgene_241324) -
For your References section:
Assessing the effect of bovine MSTN variants on pre-mRNA splicing. Gaiani N, Rocha D, Boulling A. Anim Genet. 2026 Feb;57(1):e70073. doi: 10.1002/age.70073. 10.1002/age.70073 PubMed 41614706