pX458-ARHGEF7/B-Pix
(Plasmid
#241368)
-
PurposeMammalian expression of SpCas9 and gRNA targeting ARHGEF7 (β-Pix)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 241368 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePx-458
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameARHGEF7 gRNA
-
gRNA/shRNA sequenceGACCTCGCGCACGTAGTTGCT
-
SpeciesH. sapiens (human)
-
Entrez GeneARHGEF7 (a.k.a. BETA-PIX, COOL-1, COOL1, Nbla10314, P50, P50BP, P85, P85COOL1, P85SPR, PAK3, PIXB)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458-ARHGEF7/B-Pix was a gift from Gaudenz Danuser (Addgene plasmid # 241368 ; http://n2t.net/addgene:241368 ; RRID:Addgene_241368) -
For your References section:
Morphological control of merlin-Rac antagonism in proliferation-promoting signaling. Weiss BG, Keth JM, Bhatt K, Doyal M, Hahn KM, Noh J, Isogai T, Danuser G. Sci Signal. 2025 May 20;18(887):eadk0922. doi: 10.1126/scisignal.adk0922. Epub 2025 May 20. 10.1126/scisignal.adk0922 PubMed 40392939