pLentiLox7.0-mVenus-CAGEn (Nrdj1)
(Plasmid #241404)

• Purpose: Proximity-triggered Protein Trans-Splicing between mVenus and RFP, Figure 1 in Nature Chemical Biology 20.10 (2024): 1353-1360.
• Depositing Lab: Thomas Muir
• Publication: Lee et al Nat Chem Biol. 2024 Oct;20(10):1353-1360. doi: 10.1038/s41589-024-01677-3. Epub 2024 Jul 8.

Backbone

• Vector backbone: pLentiLox7.0
• Backbone size w/o insert (bp): 6958
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mVenus-CAGEn (Nrdj1)
• Species: Synthetic
• Insert Size (bp): 1659
• Promoter: CMV
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pLentiLox7.0-mVenus-CAGEn (Nrdj1).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Engineered NrdJ-1N intein (Caged NrdJ-1N) fused to the 3'-end of mVenus-add-on sequence (NPC). FKBP* domain fussed to the 3'-end of Caged NrdJ-1N.

Please note: This plasmid lacks a 5' LTR and cannot be used to create stable cell lines by lentiviral transduction. In the original publication, the plasmid was used for transient transfection. Therefore, this sequence conflict does not impact the conclusions of the publication.