pLVX-Pax2
(Plasmid
#241796)
-
PurposeExpresses Pax2 in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVX-Tight-Puro
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePAX2
-
SpeciesH. sapiens (human)
-
GenBank IDNM_003987
-
Entrez GenePAX2 (a.k.a. FSGS7, PAPRS, PAX-2)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer GGGAATTCGTCGACTGGATC
- 3′ sequencing primer GGGAATTCTTAAACCTTATCGTCGTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriGene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.23.630121 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-Pax2 was a gift from Diego Castrillon (Addgene plasmid # 241796 ; http://n2t.net/addgene:241796 ; RRID:Addgene_241796) -
For your References section:
A distinct mechanism of epigenetic reprogramming silences PAX2 and initiates endometrial carcinogenesis. Sahoo SS, Ramanand SG, Cuevas IC, Gao Y, Lee S, Abbas A, Zhang X, Kumar A, Koduru P, Roy S, Broaddus RR, Bae-Jump VL, Gladden AB, Lea J, Lucas E, Xing C, Kobayashi A, Mani RS, Castrillon DH. J Clin Invest. 2025 Aug 15;135(16):e190989. doi: 10.1172/JCI190989. eCollection 2025 Aug 15. 10.1172/JCI190989 PubMed 40829174