pDestTol2CR-QUAS:mNeonGreen-NES-P2A-mKate2-NLS
(Plasmid
#241912)
-
PurposeZebrafish transgenesis plasmid encoding cytoplasmic mNeonGreen-NES and mKate2-NLS separated by the P2A peptide, driven by the QUAS enhancer, and including a cmlc2:mKate2 cardiac transgenesis marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241912 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDestTol2CR
- Backbone size w/o insert (bp) 7839
- Total vector size (bp) 8323
-
Vector typezebrafish Tol2 transgenesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameQUAS enhancer driving mNeonGreen-NES and mKate2-NLS
-
Insert Size (bp)1894
- Promoter QUAS
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer caactttgtatagaaaagttg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDestTol2CR-QUAS:mNeonGreen-NES-P2A-mKate2-NLS was a gift from Balázs Enyedi (Addgene plasmid # 241912 ; http://n2t.net/addgene:241912 ; RRID:Addgene_241912) -
For your References section:
Fibroblasts promote osmotic surveillance by wound-induced unique calcium patterns. Fazekas L, Kaszas D, Vamosi B, Tamas SX, Szollosi T, Mihalyi V, Dehne FG, Vago-Kiss K, Al-Sheraji NM, Paulovits B, Roux BT, Enyedi B. J Cell Biol. 2026 Jan 5;225(1):e202501165. doi: 10.1083/jcb.202501165. Epub 2025 Oct 22. 10.1083/jcb.202501165 PubMed 41123438