pDestTol2CG2-QUAS:cPla2-mKate2
(Plasmid
#241913)
-
PurposeZebrafish transgenesis plasmid encoding D. rerio cPla2-mKate2, driven by the QUAS enhancer, and including a cmlc2:EGFP cardiac transgenesis marker
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241913 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDestTol2CG2 (Tol2Kit#395)
- Backbone size w/o insert (bp) 7795
- Total vector size (bp) 9561
-
Vector typezebrafish Tol2 transgenesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameQUAS enhancer driving cPla2-mKate2
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)3198
- Promoter QUAS
-
Tag
/ Fusion Protein
- cPla2 fused to mKate2 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer caactttgtatagaaaagttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDestTol2CG2-QUAS:cPla2-mKate2 was a gift from Balázs Enyedi (Addgene plasmid # 241913 ; http://n2t.net/addgene:241913 ; RRID:Addgene_241913)
