pDestTol2CR-QUASM1:GCaMP7s-NLS-P2A-mKate2-NLS
(Plasmid
#241915)
-
PurposeZebrafish transgenesis plasmid encoding GCaMP7s-NLS and mKate2-NES separated by the P2A peptide, driven by the QUASM1 enhancer, and including a cmlc2:mKate2 cardiac transgenesis marker
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDestTol2CR
- Backbone size w/o insert (bp) 7839
- Total vector size (bp) 8977
-
Vector typezebrafish Tol2 transgenesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameQUASM1 enhancer driving GCaMP7s-NLS and mKate2-NLS
-
SpeciesSynthetic
-
Insert Size (bp)2507
- Promoter QUASM1
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer caactttgtatagaaaagttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDestTol2CR-QUASM1:GCaMP7s-NLS-P2A-mKate2-NLS was a gift from Balázs Enyedi (Addgene plasmid # 241915 ; http://n2t.net/addgene:241915 ; RRID:Addgene_241915)
