ISA179: Tagatose pathway
(Plasmid
#241968)
-
PurposePhagemid for the tagatose pathway. Contains p15A, CmR, pac site, AraC, C1, and pBAD.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15a, CamR, phagemid
-
Vector typeBacterial Expression, Synthetic Biology ; phagemid
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTagatose pathway
-
SpeciesBacillus licheniformis
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagggtacaacgaagggaaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ISA179: Tagatose pathway was a gift from Nathan Crook (Addgene plasmid # 241968 ; http://n2t.net/addgene:241968 ; RRID:Addgene_241968) -
For your References section:
Inducible directed evolution of complex phenotypes in bacteria. Al'Abri IS, Haller DJ, Li Z, Crook N. Nucleic Acids Res. 2022 Jun 10;50(10):e58. doi: 10.1093/nar/gkac094. 10.1093/nar/gkac094 PubMed 35150576