f(syn)w-CMV-mKate2-p2A-RimBP2
(Plasmid
#241989)
-
PurposeInsert coding for mouse RBP2 (accession ID NP_001074857.1) with an N-terminal mKATE2 with a p2A cleavage site cloned inframe into a f(syn)w-mKATE2-p2A.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonef(syn)w-mKate2-P2A
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRIM-BP2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3267
-
GenBank IDNP_001074857.1
-
Entrez GeneRimbp2 (a.k.a. A930033C01Rik, mKIAA0318)
- Promoter human Synapsin
-
Tag
/ Fusion Protein
- mKate2-p2A-RIMBP2 (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCAGGAGATGTTGAAGAAAA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byObtained from Maria Magdalena Picher who previously cloned the construct while at the Institute for Auditory Neuroscience, University Medical Centre, Göttingen
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.7554/eLife.98254.1 for the ELife preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
f(syn)w-CMV-mKate2-p2A-RimBP2 was a gift from Tobias Moser (Addgene plasmid # 241989 ; http://n2t.net/addgene:241989 ; RRID:Addgene_241989) -
For your References section:
Establishing synthetic ribbon-type active zones in a heterologous expression system. Kapoor R, Schwenzer N, Dresbach T, Lehnart SE, Moser T. eLife13:RP98254 10.7554/eLife.98254.1