pHREP-KD-2-shH2A
(Plasmid
#241997)
-
PurposeSleeping Beauty vector for inducible expression of a chicken H2A targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHREP-KD-2
- Total vector size (bp) 6629
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418), Puromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2A
-
gRNA/shRNA sequenceATGCGCGTCTTCTTGTTGTCGC
-
SpeciesG. gallus (chicken)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHREP-KD-2-shH2A was a gift from Lienhard Schmitz (Addgene plasmid # 241997 ; http://n2t.net/addgene:241997 ; RRID:Addgene_241997) -
For your References section:
A novel approach towards a histone replacement system in Tetrapods. Pfisterer M, Pritz A, Parry A, Schmitz ML. PLoS One. 2026 Feb 10;21(2):e0342014. doi: 10.1371/journal.pone.0342014. eCollection 2026. 10.1371/journal.pone.0342014 PubMed 41666149