pNQ058
(Plasmid
#242079)
-
PurposeExpresses rS1 as fusion with 6xHis-SUMO
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepESUMO
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerpsa
-
SpeciesE. coli
-
Insert Size (bp)1671
-
Entrez GenerpsA (a.k.a. b0911, ECK0902, ssyF)
-
Tag
/ Fusion Protein
- SUMO (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taatacgactcactataggg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNQ058 was a gift from Olivier Duss (Addgene plasmid # 242079 ; http://n2t.net/addgene:242079 ; RRID:Addgene_242079) -
For your References section:
Tracking transcription-translation coupling in real time. Qureshi NS, Duss O. Nature. 2025 Jan;637(8045):487-495. doi: 10.1038/s41586-024-08308-w. Epub 2024 Dec 4. 10.1038/s41586-024-08308-w PubMed 39633055