-
PurposeOsTIR1 variant S210A significantly enhances the overall degron efficiency, resulting in the degron system AID 2.1.
-
Depositing Lab
-
Depositing OrganizationNorthwestern University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242189 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 242189-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 242189-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMK381
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAG_OsTIR1_F74G_S210A
-
SpeciesOryza sativa (rice)
-
MutationS210A
-
GenBank ID4335696
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site MfeI (not destroyed)
- 5′ sequencing primer gcaacgtgctggttattgtg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The higher degradation efficiency of AID 2.0 (OsTIR1_F74G) comes with target-specific basal degradation and slower recovery rates. To address these limitations, we employ base-editing-mediated mutagenesis followed by several rounds of functional selection and screening. This directed protein evolution generates several gain-of-function OsTIR1 variants, including S210A, that significantly enhance the overall degron efficiency. The resulting degron system, named AID 2.1, maintains effective target protein depletion with minimal basal degradation and faster recovery after ligand washout, enabling characterization and rescue experiments for essential genes.
DNA (Catalog # 242189-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 242189-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1_CAG_OsTIR1_F74G_S210A was a gift from Mazhar Adli (Addgene plasmid # 242189 ; http://n2t.net/addgene:242189 ; RRID:Addgene_242189) -
For your References section:
Systematic comparison and base-editing-mediated directed protein evolution and functional screening yield superior auxin-inducible degron technology. Xing D, Bai T, Neyisci O, Paylakhi SZ, Duval AJ, Tekin Y, Adli M. Nat Commun. 2025 Jul 18;16(1):6631. doi: 10.1038/s41467-025-61848-1. 10.1038/s41467-025-61848-1 PubMed 40681502
Map uploaded by the depositor.
