Skip to main content

AAVS1_CAG_OsTIR1_F74G_S210A
(Plasmid #242189)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242189 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMK381
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CAG_OsTIR1_F74G_S210A
  • Species
    Oryza sativa (rice)
  • Mutation
    S210A
  • GenBank ID
    4335696
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site MfeI (not destroyed)
  • 5′ sequencing primer gcaacgtgctggttattgtg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The higher degradation efficiency of AID 2.0 (OsTIR1_F74G) comes with target-specific basal degradation and slower recovery rates. To address these limitations, we employ base-editing-mediated mutagenesis followed by several rounds of functional selection and screening. This directed protein evolution generates several gain-of-function OsTIR1 variants, including S210A, that significantly enhance the overall degron efficiency. The resulting degron system, named AID 2.1, maintains effective target protein depletion with minimal basal degradation and faster recovery after ligand washout, enabling characterization and rescue experiments for essential genes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1_CAG_OsTIR1_F74G_S210A was a gift from Mazhar Adli (Addgene plasmid # 242189 ; http://n2t.net/addgene:242189 ; RRID:Addgene_242189)
  • For your References section:

    Systematic comparison and base-editing-mediated directed protein evolution and functional screening yield superior auxin-inducible degron technology. Xing D, Bai T, Neyisci O, Paylakhi SZ, Duval AJ, Tekin Y, Adli M. Nat Commun. 2025 Jul 18;16(1):6631. doi: 10.1038/s41467-025-61848-1. 10.1038/s41467-025-61848-1 PubMed 40681502