AAVS1_CAG_OsTIR1_F74G_S210A
(Plasmid #242189)

• Purpose: OsTIR1 variant S210A significantly enhances the overall degron efficiency, resulting in the degron system AID 2.1.
• Depositing Lab: Mazhar Adli
• Publication: Xing et al Nat Commun. 2025 Jul 18;16(1):6631. doi: 10.1038/s41467-025-61848-1.

Backbone

• Vector backbone: pMK381
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CAG_OsTIR1_F74G_S210A
• Species: Oryza sativa (rice)
• Mutation: S210A
• GenBank ID: 4335696
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: MfeI (not destroyed)
• 5′ sequencing primer: gcaacgtgctggttattgtg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The higher degradation efficiency of AID 2.0 (OsTIR1_F74G) comes with target-specific basal degradation and slower recovery rates. To address these limitations, we employ base-editing-mediated mutagenesis followed by several rounds of functional selection and screening. This directed protein evolution generates several gain-of-function OsTIR1 variants, including S210A, that significantly enhance the overall degron efficiency. The resulting degron system, named AID 2.1, maintains effective target protein depletion with minimal basal degradation and faster recovery after ligand washout, enabling characterization and rescue experiments for essential genes.