pAAV-SYN1>Fas-EGFP:P2A:mNaChBac.
(Plasmid
#242230)
-
PurposeExpress Fas-EGFP and mNaChBac in neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 242230 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePAAV-Syn
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFas
-
Insert Size (bp)34
- Promoter SYN
Cloning Information for Gene/Insert 1
- Cloning method Gene Synthesis
- 5′ sequencing primer gagtgcaagtgggttttaggacc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)716
Gene/Insert 3
-
Gene/Insert nameP2A
-
SpeciesSynthetic
-
Insert Size (bp)66
Gene/Insert 4
-
Gene/Insert namemNachBac
-
SpeciesSynthetic
-
Insert Size (bp)822
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-SYN1>Fas-EGFP:P2A:mNaChBac. was a gift from Qingchun Tong (Addgene plasmid # 242230 ; http://n2t.net/addgene:242230 ; RRID:Addgene_242230) -
For your References section:
An alternative neural basis underlying leptin resistance. Li H, Su C, Xu Y, Ludwig MQ, Davis J, Tong Q. Cell Rep. 2025 Jun 19;44(7):115863. doi: 10.1016/j.celrep.2025.115863. 10.1016/j.celrep.2025.115863 PubMed 40540394