CAG-MITO-APOX
(Plasmid
#242338)
-
PurposeExpresses human APOX in mitochondrial matrix
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 242338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4799
- Total vector size (bp) 5648
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMITO-APOX-FLAG
-
Alt nameAPEX2 (F41V-S69I-Y235F-H239Y)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)849
-
MutationF41V, S69I, Y235F, H239Y
-
Entrez GeneAPEX2 (a.k.a. APE2, APEXL2, XTH2, ZGRF2)
- Promoter CAG
-
Tags
/ Fusion Proteins
- Mitochondrial matrix signal peptide (N terminal on insert)
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gctaaccatgttcatgccttc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.26434/chemrxiv-2025-07zmn for the ChemRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-MITO-APOX was a gift from Jeffrey Martell (Addgene plasmid # 242338 ; http://n2t.net/addgene:242338 ; RRID:Addgene_242338) -
For your References section:
Directed Evolution of APOX for Proximity Labeling Using Phenols with High Redox Potentials. Fang S, Acevedo LD, Solivais AJ, Zhou X, Delfosse ES, Frey BL, Smith LM, Martell JD. ChemRxiv. 2025; doi:10.26434/chemrxiv-2025-07zmn 10.26434/chemrxiv-2025-07zmn