Skip to main content

hCBLN3-EGFP
(Plasmid #242340)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242340 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4733
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cerebellin 3 Precursor
  • Alt name
    CBLN3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    575
  • Entrez Gene
    CBLN3 (a.k.a. PRO1486)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hCBLN3-EGFP was a gift from Christoph Kaether (Addgene plasmid # 242340 ; http://n2t.net/addgene:242340 ; RRID:Addgene_242340)
  • For your References section:

    Cell-type resolved protein atlas of brain lysosomes identifies SLC45A1-associated disease as a lysosomal disorder. Ghoochani A, Heiby JC, Rawat ES, Medoh UN, Di Fraia D, Dong W, Gastou M, Rastogi M, Hernandez V, Nyame K, Laqtom NN, Durso W, Valkova C, Isakova A, Kaether C, Wernig M, Gomez-Ospina N, Franke C, Ori A, Abu-Remaileh M. Cell. 2026 Feb 5;189(3):765-782.e31. doi: 10.1016/j.cell.2025.12.012. Epub 2026 Jan 22. 10.1016/j.cell.2025.12.012 PubMed 41576950