pCMV CHMP2B-L4D,F5D-M85E-3XHA
(Plasmid
#242416)
-
PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a M85E mutation and a 3xHA tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHM6
- Backbone size w/o insert (bp) 5450
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCHMP2B
-
SpeciesH. sapiens (human)
-
MutationL4D F5D M85E
-
Entrez GeneCHMP2B (a.k.a. ALS17, CHMP2.5, DMT1, FTDALS7, VPS2-2, VPS2B)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.13.632710 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV CHMP2B-L4D,F5D-M85E-3XHA was a gift from Franz-Ulrich Hartl (Addgene plasmid # 242416 ; http://n2t.net/addgene:242416 ; RRID:Addgene_242416) -
For your References section:
alpha-Synuclein aggregates inhibit ESCRT-III through sequestration and collateral degradation. Sitron CS, Trinkaus VA, Galesic A, Garhammer M, Yuste-Checa P, Dransfeld U, Feigenbutz D, Zhang J, Ivashko L, Dudanova I, Harper JW, Hartl FU. Mol Cell. 2025 Sep 18;85(18):3505-3523.e17. doi: 10.1016/j.molcel.2025.08.022. Epub 2025 Sep 10. 10.1016/j.molcel.2025.08.022 PubMed 40934925