Skip to main content

pLKO.1 mouse NT
(Plasmid #242421)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242421 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLK0.1 puro
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Non-targeting shRNA
  • gRNA/shRNA sequence
    ccggtcctaaggttaagtcgccctcgctcgagcgagggcgacttaaccttagg
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.01.13.632710 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 mouse NT was a gift from Franz-Ulrich Hartl (Addgene plasmid # 242421 ; http://n2t.net/addgene:242421 ; RRID:Addgene_242421)
  • For your References section:

    alpha-Synuclein aggregates inhibit ESCRT-III through sequestration and collateral degradation. Sitron CS, Trinkaus VA, Galesic A, Garhammer M, Yuste-Checa P, Dransfeld U, Feigenbutz D, Zhang J, Ivashko L, Dudanova I, Harper JW, Hartl FU. Mol Cell. 2025 Sep 18;85(18):3505-3523.e17. doi: 10.1016/j.molcel.2025.08.022. Epub 2025 Sep 10. 10.1016/j.molcel.2025.08.022 PubMed 40934925