pLKO.1 mouse Chmp2b
(Plasmid
#242422)
-
PurposeExpression of a Chmp2b-targeting shRNA in mouse cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 242422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLK0.1 puro
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChmp2b
-
gRNA/shRNA sequenceCCGGGCCTTAAATAGCACGAACATActcgagTATGTTCGTGCTATTTAAGGC
-
SpeciesM. musculus (mouse)
-
Entrez GeneChmp2b (a.k.a. 1190006E07Rik)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.13.632710 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 mouse Chmp2b was a gift from Franz-Ulrich Hartl (Addgene plasmid # 242422 ; http://n2t.net/addgene:242422 ; RRID:Addgene_242422)