AGG1829 OpIE2-Bn
(Plasmid
#242438)
-
PurposeInsect OpIE2 promoter expressing barnase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 242438 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTwist-Amp
-
Backbone manufacturerTwist Bioscience
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBarnase
-
SpeciesBacillus amyloliquefaciens
-
Insert Size (bp)504
-
Entrez GeneJ5X95_RS06160 (a.k.a. J5X95_RS06160, J5X95_06160)
- Promoter OpIE2
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer M13F - CGCCAGGGTTTTCCCAGTCACGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AGG1829 OpIE2-Bn was a gift from Luke Alphey (Addgene plasmid # 242438 ; http://n2t.net/addgene:242438 ; RRID:Addgene_242438) -
For your References section:
Harnessing the highly adaptable barnase-barstar system for genetic biocontrol of Aedes aegypti. Nevard K, Ang JXD, Anderson MAE, Gonzalez E, Shackleford L, Alphey L. Commun Biol. 2025 Aug 4;8(1):1154. doi: 10.1038/s42003-025-08588-6. 10.1038/s42003-025-08588-6 PubMed 40760041