Skip to main content
Addgene
Open Menu

AGG1767 PUb-Bs-TRE-Bn
(Plasmid #242441)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242441 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pUC57
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Barstar
  • Promoter AePUb

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site DraIII (unknown if destroyed)
  • 3′ cloning site AsiSI (unknown if destroyed)
  • 5′ sequencing primer m13R- CGGATAACAATTTCACACAG
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    DsRED
  • Promoter Hr5/IE1

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    barnase
  • Promoter TRE

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (destroyed during cloning)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer LA6098 actaagcgcggtgaaacccaattgaac
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AGG1767 PUb-Bs-TRE-Bn was a gift from Luke Alphey (Addgene plasmid # 242441 ; http://n2t.net/addgene:242441 ; RRID:Addgene_242441)

  • For your References section:

    Harnessing the highly adaptable barnase-barstar system for genetic biocontrol of Aedes aegypti. Nevard K, Ang JXD, Anderson MAE, Gonzalez E, Shackleford L, Alphey L. Commun Biol. 2025 Aug 4;8(1):1154. doi: 10.1038/s42003-025-08588-6. 10.1038/s42003-025-08588-6 PubMed 40760041
Related items: