AGG1767 PUb-Bs-TRE-Bn
(Plasmid
#242441)
-
PurposeAe aegypti PUb promoter expressing barstar, and TRE expressing barnase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242441 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameBarstar
- Promoter AePUb
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site DraIII (unknown if destroyed)
- 3′ cloning site AsiSI (unknown if destroyed)
- 5′ sequencing primer m13R- CGGATAACAATTTCACACAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameDsRED
- Promoter Hr5/IE1
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer LA325 aacccatgattatttgattaaa
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namebarnase
- Promoter TRE
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (destroyed during cloning)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer LA6098 actaagcgcggtgaaacccaattgaac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AGG1767 PUb-Bs-TRE-Bn was a gift from Luke Alphey (Addgene plasmid # 242441 ; http://n2t.net/addgene:242441 ; RRID:Addgene_242441) -
For your References section:
Harnessing the highly adaptable barnase-barstar system for genetic biocontrol of Aedes aegypti. Nevard K, Ang JXD, Anderson MAE, Gonzalez E, Shackleford L, Alphey L. Commun Biol. 2025 Aug 4;8(1):1154. doi: 10.1038/s42003-025-08588-6. 10.1038/s42003-025-08588-6 PubMed 40760041