Skip to main content

pGL4-CMV-FLAG-XPO1
(Plasmid #242459)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242459 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL4
  • Backbone size w/o insert (bp) 3225
  • Total vector size (bp) 6465
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    XPO1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3240
  • Entrez Gene
    XPO1 (a.k.a. CRM-1, CRM1, emb, exp1)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CACTGCATTCTAGTTGTGGTTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.10.07.617049 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4-CMV-FLAG-XPO1 was a gift from Dirk Daelemans (Addgene plasmid # 242459 ; http://n2t.net/addgene:242459 ; RRID:Addgene_242459)
  • For your References section:

    SINE compounds activate exportin 1 degradation through an allosteric mechanism. Wing CE, Fung HYJ, Kwanten B, Cagatay T, Niesman AB, Jacquemyn M, Gharghabi M, Permentier B, Shakya B, Nandi R, Ready JM, Kashyap T, Shacham S, Landesman Y, Lapalombella R, Daelemans D, Chook YM. Nat Chem Biol. 2025 Dec;21(12):2002-2013. doi: 10.1038/s41589-025-02058-0. Epub 2025 Nov 21. 10.1038/s41589-025-02058-0 PubMed 41286136