pGL4-CMV-FLAG-XPO1
(Plasmid
#242459)
-
PurposeExpresses human XPO1 with an N-terminal FLAG tag for pull-down assays.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242459 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL4
- Backbone size w/o insert (bp) 3225
- Total vector size (bp) 6465
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXPO1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3240
-
Entrez GeneXPO1 (a.k.a. CRM-1, CRM1, emb, exp1)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CACTGCATTCTAGTTGTGGTTTGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4-CMV-FLAG-XPO1 was a gift from Dirk Daelemans (Addgene plasmid # 242459 ; http://n2t.net/addgene:242459 ; RRID:Addgene_242459) -
For your References section:
SINE compounds activate exportin 1 degradation through an allosteric mechanism. Wing CE, Fung HYJ, Kwanten B, Cagatay T, Niesman AB, Jacquemyn M, Gharghabi M, Permentier B, Shakya B, Nandi R, Ready JM, Kashyap T, Shacham S, Landesman Y, Lapalombella R, Daelemans D, Chook YM. Nat Chem Biol (2025) 21, 2002–2013. 10.1038/s41589-025-02058-0 PubMed 39416201