pLCKO-CMV-cMyc-UBC_K7R-IRES-Blasti
(Plasmid
#242463)
-
PurposeExpresses human UBC protein with an N-terminal cMyc tag enabling UBC pull down along with a blasticidin selection marker. The K7R mutations prevent ubiquitin chain elongation.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLCKO
- Backbone size w/o insert (bp) 7762
- Total vector size (bp) 8023
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUBC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)258
-
MutationUBC-K7R
-
Entrez GeneUBC (a.k.a. HMG20)
- Promoter CMV
-
Tag
/ Fusion Protein
- cMyc (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLCKO-CMV-cMyc-UBC_K7R-IRES-Blasti was a gift from Dirk Daelemans (Addgene plasmid # 242463 ; http://n2t.net/addgene:242463 ; RRID:Addgene_242463) -
For your References section:
SINE compounds activate exportin 1 degradation through an allosteric mechanism. Wing CE, Fung HYJ, Kwanten B, Cagatay T, Niesman AB, Jacquemyn M, Gharghabi M, Permentier B, Shakya B, Nandi R, Ready JM, Kashyap T, Shacham S, Landesman Y, Lapalombella R, Daelemans D, Chook YM. Nat Chem Biol (2025) 21, 2002–2013. 10.1038/s41589-025-02058-0 PubMed 39416201