pGL4-CMV-myc-XPO1_H10-11
(Plasmid
#242471)
-
PurposeExpresses human XPO1 protein with an N-terminal cMyc tag. The H10-11 mutations disrupt ASB8 binding.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242471 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL4
- Backbone size w/o insert (bp) 3225
- Total vector size (bp) 6471
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXPO1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3246
-
MutationXPO1 H10-11 = E478A - H481A - V484G - N485G - T487G - D523G
-
Entrez GeneXPO1 (a.k.a. CRM-1, CRM1, emb, exp1)
- Promoter CMV
-
Tag
/ Fusion Protein
- cMyc (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CACTGCATTCTAGTTGTGGTTTGTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.10.07.617049 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4-CMV-myc-XPO1_H10-11 was a gift from Dirk Daelemans (Addgene plasmid # 242471 ; http://n2t.net/addgene:242471 ; RRID:Addgene_242471) -
For your References section:
SINE compounds activate exportin 1 degradation through an allosteric mechanism. Wing CE, Fung HYJ, Kwanten B, Cagatay T, Niesman AB, Jacquemyn M, Gharghabi M, Permentier B, Shakya B, Nandi R, Ready JM, Kashyap T, Shacham S, Landesman Y, Lapalombella R, Daelemans D, Chook YM. Nat Chem Biol. 2025 Dec;21(12):2002-2013. doi: 10.1038/s41589-025-02058-0. Epub 2025 Nov 21. 10.1038/s41589-025-02058-0 PubMed 41286136