Skip to main content

Nluc CD63
(Plasmid #242528)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242528 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmRFP1-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4689
  • Total vector size (bp) 5224
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD63
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    714
  • GenBank ID
    NM_001780.6
  • Entrez Gene
    CD63 (a.k.a. AD1, HOP-26, ME491, MLA1, OMA81H, Pltgp40, TSPAN30)
  • Promoter CMV
  • Tag / Fusion Protein
    • Nanoluciferase (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer polyA Reverse: GTAACCATTATAAGCTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    W. Mothes

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Nluc CD63 was a gift from Clotilde Thery (Addgene plasmid # 242528 ; http://n2t.net/addgene:242528 ; RRID:Addgene_242528)
  • For your References section:

    Homosalate boosts the release of tumour-derived extracellular vesicles with protection against anchorage-loss property. Grisard E, Nevo N, Lescure A, Doll S, Corbe M, Jouve M, Lavieu G, Joliot A, Nery ED, Martin-Jaular L, Thery C. J Extracell Vesicles. 2022 Jul;11(7):e12242. doi: 10.1002/jev2.12242. 10.1002/jev2.12242 PubMed 35790086