Nluc CD63
(Plasmid #242528)

• Purpose: This plasmid can be used to quantify CD63 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.
• Depositing Lab: Clotilde Thery
• Publication: Grisard et al J Extracell Vesicles. 2022 Jul;11(7):e12242. doi: 10.1002/jev2.12242.

Backbone

• Vector backbone: pmRFP1-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4689
• Total vector size (bp): 5224
• Vector type: Mammalian Expression, Luciferase
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CD63
• Species: H. sapiens (human)
• Insert Size (bp): 714
• GenBank ID: NM_001780.6
• Entrez Gene: CD63 (a.k.a. AD1, HOP-26, ME491, MLA1, OMA81H, Pltgp40, TSPAN30)
• Promoter: CMV
• Tag / Fusion Protein:
  • Nanoluciferase (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CMV Forward: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: polyA Reverse: GTAACCATTATAAGCTGC

Resource Information

• Supplemental Documents:
  • NlucCD63.Plasmid_annotations.gbk
• A portion of this plasmid was derived from a plasmid made by: W. Mothes

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry