Skip to main content

pJL052
(Plasmid #242610)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242610 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSICO derivative
  • Backbone size w/o insert (bp) 8883
  • Total vector size (bp) 8903
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sgRNA
  • gRNA/shRNA sequence
    GAGACTCGCGTGTGGCCCCA
  • Promoter modified human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site BlpI (not destroyed)
  • 5′ sequencing primer GGACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jonathan Weissman (Addgene #111594, pLG_GI3)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL052 was a gift from Brittany Adamson (Addgene plasmid # 242610 ; http://n2t.net/addgene:242610 ; RRID:Addgene_242610)
  • For your References section:

    Mapping the Genetic Interaction Network of PARP inhibitor Response. Simpson D, Ling J, Jing Y, Adamson B. bioRxiv [Preprint]. 2023 Aug 20:2023.08.19.553986. doi: 10.1101/2023.08.19.553986. 10.1101/2023.08.19.553986 PubMed 37645833