JARID1D-HE-AA
(Plasmid
#242617)
-
PurposeExpresses catalytic mutant JARID1D
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242617 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFLAG-CMV2
-
Backbone manufacturerSigma
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 9149
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJARID1D-HE-AA
-
Alt nameKDM5D
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4449
-
GenBank IDNM_001146706.2
-
Entrez GeneKDM5D (a.k.a. HY, HYA, JARID1D, SMCY)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
JARID1D-HE-AA was a gift from Min Gyu Lee (Addgene plasmid # 242617 ; http://n2t.net/addgene:242617 ; RRID:Addgene_242617) -
For your References section:
JARID1D Is a Suppressor and Prognostic Marker of Prostate Cancer Invasion and Metastasis. Li N, Dhar SS, Chen TY, Kan PY, Wei Y, Kim JH, Chan CH, Lin HK, Hung MC, Lee MG. Cancer Res. 2016 Feb 15;76(4):831-43. doi: 10.1158/0008-5472.CAN-15-0906. Epub 2016 Jan 8. 10.1158/0008-5472.CAN-15-0906 PubMed 26747897