pAAV-hsyn-DIO-AppNL-G-F-T2A-mCherry
(Plasmid
#242649)
-
PurposeFloxed (DIO) AAV transgene designed to be packaged in AAV and to express the amyloid precursor protein (App) with familial mutations AppNL-G-F in a Cre-recombinase-dependent manner.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 7850
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFloxed (DOI) AAV transgene expressing an amyloid precursor protein with familial mutations and an mCherry tag
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)5200
-
MutationThe amyloid precursor reading frame contains a combination of familial Alzheimer's Disease mutations. AppNL-G-F allele includes three human mutations causing overproduction of Aβ.
- Promoter human synapsin
Cloning Information
- Cloning method Other
- 5′ sequencing primer gactcagcgctgcctcagtc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe complete insert was made by gene synthesis.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Nollet M, Ba W, Anuncibay Soto B, Lin C, Jovic K, Vyssotski AL, Yustos R, Franks NP, Wisden (W 2025) The selective amyloid-driven failure of cholinergic medial septal neurons in aging mice perturbs REM sleep, cognition and emotion, and broadcasts amyloid to other brain regions. https://doi.org/10.1101/2025.07.09.663930
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hsyn-DIO-AppNL-G-F-T2A-mCherry was a gift from William Wisden (Addgene plasmid # 242649 ; http://n2t.net/addgene:242649 ; RRID:Addgene_242649)