pAAV-hsyn-DIO-AppNL-G-F-T2A-mCherry
(Plasmid #242649)

• Purpose: Floxed (DIO) AAV transgene designed to be packaged in AAV and to express the amyloid precursor protein (App) with familial mutations AppNL-G-F in a Cre-recombinase-dependent manner.
• Depositing Lab: William Wisden
• Publication: AAV transgenes to express familial Alzheimer's disease (unpublished)

Backbone

• Vector backbone: pUC
• Backbone size w/o insert (bp): 2900
• Total vector size (bp): 7850
• Vector type: Mammalian Expression, Mouse Targeting, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Floxed (DOI) AAV transgene expressing an amyloid precursor protein with familial mutations and an mCherry tag
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 5200
• Mutation: The amyloid precursor reading frame contains a combination of familial Alzheimer's Disease mutations. AppNL-G-F allele includes three human mutations causing overproduction of Aβ.
• Promoter: human synapsin

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: gactcagcgctgcctcagtc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The complete insert was made by gene synthesis.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Nollet M, Ba W, Anuncibay Soto B, Lin C, Jovic K, Vyssotski AL, Yustos R, Franks NP, Wisden (W 2025) The selective amyloid-driven failure of cholinergic medial septal neurons in aging mice perturbs REM sleep, cognition and emotion, and broadcasts amyloid to other brain regions. https://doi.org/10.1101/2025.07.09.663930

https://www.biorxiv.org/content/10.1101/2025.07.09.663930v1