Skip to main content

C-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse) (LLH310)
(Plasmid #242662)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242662 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Cbh_v5 AAV-ABE C-terminal (Addgene Plasmid #137178)
  • Vector type
    AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_mouse_NGA_gRNA-pU6
  • Alt name
    LLH310
  • Alt name
    C-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse)
  • gRNA/shRNA sequence
    GTGCATCTGGACTTGGCTGGC
  • Species
    Synthetic
  • Mutation
    VRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335Q/T1337R)
  • Promoter CBh
  • Tags / Fusion Proteins
    • BPNLS (N terminal on insert)
    • BPNLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer oBK7321-GGGCTGTAATTAGCTGAGCAAGAGG
  • 3′ sequencing primer oBK219-GGGAGTGGCACCTTCCAGGGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    C-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse) (LLH310) was a gift from Benjamin Kleinstiver (Addgene plasmid # 242662 ; http://n2t.net/addgene:242662 ; RRID:Addgene_242662)
  • For your References section:

    Treatment of a severe vascular disease using a bespoke CRISPR-Cas9 base editor in mice. Alves CRR, Das S, Krishnan V, Ha LL, Fox LR, Stutzman HE, Shamber CE, Kalailingam P, McCarthy S, Lino Cardenas CL, Fong CE, Imai T, Mitra S, Yun S, Wood RK, Benning FMC, Roh K, Lawton J, Kim N, Silverstein RA, Ferreira da Silva J, de la Cruz D, Richa R, Xie J, Gray-Edwards HL, Malhotra R, Chung DY, Chao LH, Tsai SQ, Maguire CA, Lindsay ME, Kleinstiver BP, Musolino PL. Nat Biomed Eng. 2025 Sep 11:10.1038/s41551-025-01499-1. doi: 10.1038/s41551-025-01499-1. 10.1038/s41551-025-01499-1 PubMed 40935887