C-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse) (LLH310)
(Plasmid
#242662)
-
PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and mouse gRNA-A4
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneCbh_v5 AAV-ABE C-terminal (Addgene Plasmid #137178)
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_mouse_NGA_gRNA-pU6
-
Alt nameLLH310
-
Alt nameC-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse)
-
gRNA/shRNA sequenceGTGCATCTGGACTTGGCTGGC
-
SpeciesSynthetic
-
MutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335Q/T1337R)
- Promoter CBh
-
Tags
/ Fusion Proteins
- BPNLS (N terminal on insert)
- BPNLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer oBK7321-GGGCTGTAATTAGCTGAGCAAGAGG
- 3′ sequencing primer oBK219-GGGAGTGGCACCTTCCAGGGTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
C-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse) (LLH310) was a gift from Benjamin Kleinstiver (Addgene plasmid # 242662 ; http://n2t.net/addgene:242662 ; RRID:Addgene_242662) -
For your References section:
Treatment of a severe vascular disease using a bespoke CRISPR-Cas9 base editor in mice. Alves CRR, Das S, Krishnan V, Ha LL, Fox LR, Stutzman HE, Shamber CE, Kalailingam P, McCarthy S, Lino Cardenas CL, Fong CE, Imai T, Mitra S, Yun S, Wood RK, Benning FMC, Roh K, Lawton J, Kim N, Silverstein RA, Ferreira da Silva J, de la Cruz D, Richa R, Xie J, Gray-Edwards HL, Malhotra R, Chung DY, Chao LH, Tsai SQ, Maguire CA, Lindsay ME, Kleinstiver BP, Musolino PL. Nat Biomed Eng. 2025 Sep 11:10.1038/s41551-025-01499-1. doi: 10.1038/s41551-025-01499-1. 10.1038/s41551-025-01499-1 PubMed 40935887