pLenti-shDLD #1
(Plasmid
#242706)
-
PurposeshRNA knockdown human DLD gene
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 242706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO.1
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDLD
-
gRNA/shRNA sequenceGCTGGAGAAATGGTAAATGAA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)58
-
Entrez GeneDLD (a.k.a. DLDD, DLDH, E3, GCSL, LAD, OGDC-E3, PHE3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer common
- 3′ sequencing primer common (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-shDLD #1 was a gift from Xingguo Zhu (Addgene plasmid # 242706 ; http://n2t.net/addgene:242706 ; RRID:Addgene_242706)