pAV-CAG-H2B-mTagBFP2-WPRE-pA
(Plasmid
#242711)
-
PurposeExpression of H2B-mTagBFP2 for nuclei isolation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242711 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonessAAV
-
Backbone manufacturerVectorBuilder
- Backbone size w/o insert (bp) 5542
- Total vector size (bp) 6652
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1110
-
Entrez GeneH2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
- Promoter CAG
-
Tag
/ Fusion Protein
- mTagBFP2 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TACGGTCTCGGTCGCTTCAGA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byVectorBuilder
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAV-CAG-H2B-mTagBFP2-WPRE-pA was a gift from Maria Galazo (Addgene plasmid # 242711 ; http://n2t.net/addgene:242711 ; RRID:Addgene_242711)